Of the pROK2 vector and the sequence of pBIN19.ġ0.
OF BIOLOGICALLY-ACTIVE VIRAL SATELLITE RNA FROM THE NUCLEAR GENOME OF TRANSFORMED Q: What is the T-DNA transformation vectorīAULCOMBE DC, SAUNDERS GR, BEVAN MW, MAYO MA, HARRISON BD EXPRESSION To not express the drug resistance phenotype.ĩ. Thus, it is not unusual for a mutant line However after several generations of growth, some of the lines Q: What is the plant selectable marker used What generation (posttransformation) are these seeds?įrom ABRC and NASC are segregating T3 lines.Ĩ. Q: The ABRC or NASC has sent me seeds for a Salk insertion Will not distribute seeds to individual laboratories.ħ. Seed requested should beĭirected to these stock centers. Line are made available through ABRC and NASC. Q: How can I obtain seeds for the Salk insertionĪ: Seeds for all sequenced indexed insertion Q: Are multiple T-DNA insertions amplifiedĪ: In most cases, we have identified only 1 T-DNA flankingĦ. Q: What is the number of T-DNA inserts perĪ: Approximately 50% of the lines containĪ single insert, the other 50% of lines contain two or more inserts.ĥ. (it is actually transferred T-DNA) and our iSect primer design tool.Ĥ. PCR at the other end of the insertion? Is the right border less predictable in its insertion pattern?Ī: Please use the RB in the pBIN-pROK2 insertion sequences or try to use the sequences Q: Is there any way to design a Right Border primer for Q: Which T-DNA border flanking sequences wereĪmplified and sequenced? What are the primers do you use for left border PCR?Ī: The T-DNA left border sequence was usedįor PCR amplification of plant flanking sequences.įor PCR 1, we use LBa1 primer: 5' tggttcacgtagtgggccatcg 3'įor PCR 2 and sequencing, we use LBb1 primer: 5' gcgtggaccgcttgctgcaact 3'ģ. A User's Guide to the Arabidopsis T-DNA Insertional Mutant CollectionsĪ: Columbia-0 (CS60000, the sequenced genome)Ģ.